Review



3′ sequencing barcoding  (10X Genomics)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    10X Genomics 3′ sequencing barcoding
    Mouse spermatogenesis single-cell RNA-seq datasets.
    3′ Sequencing Barcoding, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc07302054-8-14-15?v=10X+Genomics
    Average 90 stars, based on 1 article reviews
    3′ sequencing barcoding - by Bioz Stars, 2026-07
    90/100 stars

    Images

    1) Product Images from "What has single-cell RNA-seq taught us about mammalian spermatogenesis?"

    Article Title: What has single-cell RNA-seq taught us about mammalian spermatogenesis?

    Journal: Biology of Reproduction

    doi: 10.1093/biolre/ioz088

    Mouse spermatogenesis single-cell RNA-seq datasets.
    Figure Legend Snippet: Mouse spermatogenesis single-cell RNA-seq datasets.

    Techniques Used: Knock-Out, Transplantation Assay, Sequencing

    Human spermatogenesis single-cell RNA-seq datasets.
    Figure Legend Snippet: Human spermatogenesis single-cell RNA-seq datasets.

    Techniques Used: Sequencing



    Similar Products

    3 feature barcode capture sequence  (TaKaRa)
    94
    TaKaRa 3 feature barcode capture sequence
    3 Feature Barcode Capture Sequence, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/bio_rxiv__2025__10__08__681007-230-12-25?v=TaKaRa
    Average 94 stars, based on 1 article reviews
    3 feature barcode capture sequence - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    barcode sequence at the illumina 3′ adapter  (Illumina Inc)
    90
    Illumina Inc barcode sequence at the illumina 3′ adapter
    Barcode Sequence At The Illumina 3′ Adapter, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pm38878913-76-10-10?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    barcode sequence at the illumina 3′ adapter - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    universal primers (343f—5′-tacggraggcagcag-3′, 798r—5′-agggtatctaatcct-3′) incorporating sequencing adapter barcode sequence  (Illumina Inc)
    90
    Illumina Inc universal primers (343f—5′-tacggraggcagcag-3′, 798r—5′-agggtatctaatcct-3′) incorporating sequencing adapter barcode sequence
    Universal Primers (343f—5′ Tacggraggcagcag 3′, 798r—5′ Agggtatctaatcct 3′) Incorporating Sequencing Adapter Barcode Sequence, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc08570021-108-28-23?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    universal primers (343f—5′-tacggraggcagcag-3′, 798r—5′-agggtatctaatcct-3′) incorporating sequencing adapter barcode sequence - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    3′ illumina truseq sequencing adapter with barcodes  (Illumina Inc)
    90
    Illumina Inc 3′ illumina truseq sequencing adapter with barcodes
    3′ Illumina Truseq Sequencing Adapter With Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc08467165-68-12-7?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    3′ illumina truseq sequencing adapter with barcodes - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    3′ sequencing barcoding  (10X Genomics)
    90
    10X Genomics 3′ sequencing barcoding
    Mouse spermatogenesis single-cell RNA-seq datasets.
    3′ Sequencing Barcoding, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc07302054-8-14-15?v=10X+Genomics
    Average 90 stars, based on 1 article reviews
    3′ sequencing barcoding - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);  (ChemGenes corporation)
    90
    ChemGenes corporation barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);
    Mouse spermatogenesis single-cell RNA-seq datasets.
    Barcoded Bead, Sequence (5’ To 3’): Toyopearl Linker Beads Tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc07193604__41467_2020_15765_MOESM2_ESM-105-8-24?v=ChemGenes+corporation
    Average 90 stars, based on 1 article reviews
    barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    primers with illumina sequencing adapters, sample-specific barcodes, and 3′ linkers  (Illumina Inc)
    90
    Illumina Inc primers with illumina sequencing adapters, sample-specific barcodes, and 3′ linkers
    Mouse spermatogenesis single-cell RNA-seq datasets.
    Primers With Illumina Sequencing Adapters, Sample Specific Barcodes, And 3′ Linkers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc06573857-124-26-20?v=Illumina+Inc
    Average 90 stars, based on 1 article reviews
    primers with illumina sequencing adapters, sample-specific barcodes, and 3′ linkers - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    forward (5’-acactgacgacatggttctaca-3’) common sequence (cs) tag for downstream barcoding  (fluidigm)
    90
    fluidigm forward (5’-acactgacgacatggttctaca-3’) common sequence (cs) tag for downstream barcoding
    Mouse spermatogenesis single-cell RNA-seq datasets.
    Forward (5’ Acactgacgacatggttctaca 3’) Common Sequence (Cs) Tag For Downstream Barcoding, supplied by fluidigm, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/3%E2%80%B2+sequencing+and+barcoding/pmc06436966-170-18-6?v=fluidigm
    Average 90 stars, based on 1 article reviews
    forward (5’-acactgacgacatggttctaca-3’) common sequence (cs) tag for downstream barcoding - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Mouse spermatogenesis single-cell RNA-seq datasets.

    Journal: Biology of Reproduction

    Article Title: What has single-cell RNA-seq taught us about mammalian spermatogenesis?

    doi: 10.1093/biolre/ioz088

    Figure Lengend Snippet: Mouse spermatogenesis single-cell RNA-seq datasets.

    Article Snippet: scRNA-seq Chemistry/Method , 3′ sequencing and full length sequence (SMART-seq2) , 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (Oliginal Drop-seq) , 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (SMART-seq2 and Microwell-seq) , full length sequence (Fluidigm C1), 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (10x Genomics) , full length sequence (Fluidigm C1) , full length sequence (Fluidigm C1) , 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (10x Genomics) , full length sequence (Fluidigm C1).

    Techniques: Knock-Out, Transplantation Assay, Sequencing

    Human spermatogenesis single-cell RNA-seq datasets.

    Journal: Biology of Reproduction

    Article Title: What has single-cell RNA-seq taught us about mammalian spermatogenesis?

    doi: 10.1093/biolre/ioz088

    Figure Lengend Snippet: Human spermatogenesis single-cell RNA-seq datasets.

    Article Snippet: scRNA-seq Chemistry/Method , 3′ sequencing and full length sequence (SMART-seq2) , 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (Oliginal Drop-seq) , 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (SMART-seq2 and Microwell-seq) , full length sequence (Fluidigm C1), 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (10x Genomics) , full length sequence (Fluidigm C1) , full length sequence (Fluidigm C1) , 3′ sequencing and barcoding (10x Genomics) , 3′ sequencing and barcoding (10x Genomics) , full length sequence (Fluidigm C1).

    Techniques: Sequencing